Fuel for the Fire 2022
Mar 31, 2022 23:41:47 GMT -5
Mongo the Destroyer, Curtis D. Kanyon, and 1 more like this
Post by Vodka Fizz on Mar 31, 2022 23:41:47 GMT -5
Wright: Ladies and Gentlemen, welcome to Fuel for the Fire 2022!
Park: We have a stacked card tonight, but I understand that Vodka Fizz will be doing the Lighting of the Fire tonight. So without further ado, here is the heart of Fireside!
The crowd cheers as Vodka walks out by the ceremonial flame. Vodka looks out over the crowd, silently considering the crowd before he produces a zippo lighter from his pocket. He looks at it for a long moment, considering the flame, before he drops it in the brazier, which roars to life. Vodka watches the fire for a moment, taking one last look at the crows and raising a fist before he walks away without saying a word.
Walter Stanford: The following contest is scheduled for ONE FALL and has a ten minute time limit! Introducing first, hailing from Eugene, Oregon. Standing six feet three inches tall and weighing in at two hundred and twenty eight pounds, this is... SHANE LOCKE!
The first guitar chords hit. Then that voice leading into "A Country Boy Can Survive" by Hank Williams Jr hits over the PA. Almost immediately, pacing in tune with the music is a tall, strongly structured gentleman. He has simple green trunks with double yellow vertical stripes on each side. Black knee pads and tall black boots finish off the simple wrestling ensemble.
Unjoo Park: Shane Locke made his recent return to FIRESIDE last Inferno to bring back his Hark Work Open Challenge. In spirit of the premium live event tonight he's extended his usual 5 minute challenge to 10 minutes!
Locke wastes little time heading to the ring, not bothering with exchanging high fives, not bothering with jibes, simply keeping an eye on the ring. Locke's reddish-brown mullet is capped with a heavily worn John Deere cap and his strong looking but not necessarily "jacked" frame is wrapped with a sleeveless flannel work shirt. He has a thick neck, wide chest and back, body hair evident. He has a frame powered by a lifetime of hard work rather then a gym. His forearms as especially think, capped with gnarled, thick hands and fingers.
Oliver Wright: This man is a specimen! A beast! I love watching him manhandle everyone in short time!
He takes no time to hit the steps and walk on in, wiping his boots on the apron before stepping in and heading right to his corner. He discards his shirt, throwing it to the side, taking off his hat with some reverence.
Walter Stanford: And his opponent, hailing from Amsterdam, Netherlands. Standing six feet two inches tall and weighing in at two hundred and fifteen pounds, he is... ALEXANDER VON BLANKENSHIP!
A thick cloud like haze fills the entry way, and brilliant blue lights create an almost angelic like atmosphere.
I've been blessed up (geez)
I've been broke down (oh yeah)
Gotta catch up (yeah)
Gotta shine now (okay)
Running faster (oh yeah)
I can't slow down (oh no)
Gotta catch up (yeah)
Gotta shine now
AVB steps from behind the curtain, a cocky smirk on his smug face. He holds his arms out, soaking in all of his own glory, before mouthing the words "Always Very Blessed" as he points to the smug look on his own face.
Ayy, I got the moves
Bearing that fruit and now I got the juice (juice!)
God has been cooking, now I got the soup
Put this together, yo, really He clever, I cannot do better
AVB looks out at the crowd, he smirk now a scowl. Slowly walking towards the ring he points to random fans, stating loudly " I'm better then you" as he goes.
Ride the wave, yeah
Ain't got no fright today, yeah
I'm gonna rise today, yeah
Don't gotta fight the wave
'Cause
I'm peeping the visuals, I bring the visuals
AVB walks up the steps to the ring, stopping before he gets inside, he gives the ring a father son and holy sport blessing before climbing the outside turnbuckle, looking towards the entire crowd he yells out "Always Very Blessed" before jumping down into the ring.
I've been blessed up (geez)
I've been broke down (oh yeah)
Gotta catch up (yeah)
Gotta shine now (okay)
Running faster (oh yeah)
I can't slow down (oh no)
Gotta catch up (yeah)
Gotta shine now
Oliver Wright: AvB is a hot up-and-comer in the circuit! The legitimate son of XHF Legend Rat Bastard if you can believe that!
Unjoo Park: Considering Rat tries to put his junk in anything with a pulse that isn't hard to believe.
DING DING DING!
The bell rings and Shane Locke circles the ring with the son of a Rat Bastard, Alexander von Blankenship! AvB accepts a locke up with the host of Ten Minutes of Good Ol' Hard Work and immediately is backed into a corner! Shane Locke powers the young gun into a corner and holds him there while referee Melanie Davenport gives him a five count to let go of the hold. Locke lets go at three, backing away with his hands up before AvB plants a thumb in his eye!
Oliver Wright: What a sick display by the debuting Blankenship! Come on dude, you're signed up for Good Ol' Hard Work not a dirty scrap!
Unjoo Park: A match is a match Wright, and sometimes you gotta do what you gotta do to earn that dub! Even if that means getting your hands dirty. Something he must have learned from ol' Papa Bastard!
Locke stumbles backwards, palm over his eye and temporarily blinded. Blankenship runs him over with a huge clothesline and flexes for the crowd, a large grin on his hand. He picks Locke up and Irish whips him into the ropes, receiving a mean shoulder block for his troubles. AvB falls onto the mat as Shane Locke takes the reigns. He deadlifts AvB off the mat and up over his head, before dropping him onto his shoulder and powerslamming him on the floor! Alexander writhes in pain as Locke focuses on the back of his opponent, rolling him over and delivering some stiff knees to AvB's back!
Unjoo Park: Those are the kind of knees that'd make anyone wince in pain. Not Unjoo Park! Those are the knees I'd be giving out!
Oliver Wright: Regardless of how devastating you used to be, Blankenship is feeling the pain now! A few good knees as payback for that eye poke earlier.
Locke gets down and begins to ground and pound on his opponent, getting pushed off after a few stiff strikes to the dome of the smug AvB. Blankenship pushes himself to his feet and begins to fight out of the Hark Work onslaught. A few quick torso punches and a headbutt collision stuns both men, before AvB bounces off the ropes and clocks Locke with a huge clothesline! Locke falls and rolls backwards, landing on his knees and laughing! He laughs at the offspring of two-time X*Crown Champion Rat Bastard dammit! Alex hates that, he yells at Locke and demands he do better! And Locke takes that challenge. He gets to his feet and hits the ropes, blasting AvB with a LARIAT!
Oliver Wright: You wanted a clothesline, Rat Jr? How did that taste?
Unjoo Park: Now THAT is some Hard Work!
Close to the usual 5-minute mark his challenges routinely go to, Shane Locke is starting to feel the pressure. He picks up AvB but Blankenship pushes off his shoulders and kicks him behind the knee! He then grabs Locke by the shoulders and tosses him into the ring post! Locke gets posted hard and hands off that bottom turnbuckle, in a world of pain. Alex puts his knee to the back of Alex's throat, choking the life out of the family man! Melanie begins to count him, Blankenship letting off at the last second while shouting at the ref, asking if she knows who his dad is. Davenport doesn't care, and tells him that while she's in the ring he'll play by her rules.
Unjoo Park: Referee Melanie Davenport getting a up-close-and-personal experience of the Blankenship ride.
Oliver Wright: Poor Ms. Davenport. Just trying to do her job and getting Karen'd for her troubles.
Shane has slumped off the turnbuckle and is coughing up a storm on the apron. AvB grabs him by the hair and lifts him up over the ropes for a vertical suplex powerslam! Shane bounces off the mat and holds the back of his neck as Alex continues to pose and jaw off at the crowd, getting jeers in retaliation. The crowd begins to rally behind Shane Locke, who gets pushed by the support for him to rise up. Blankenship does not appreciate this ungiving up and tees off on the skull of his foe. Lefts and rights from Your Grace, Shane Locke refuses to back down. In fact he's all the more motivated to get up and begins to slug back on AvB! Lefts and rights! Fists and chops! Bombs thrown at one another!
Oliver Wright: Seven and a half minutes into this contest and it's looking like we may run out of the allotted 10 minutes here!
Unjoo Park: If either of these guys truly want the win they'll try their damnedest to take that win in these closing moments!
Shane Locke powers Blankenship into a corner, beating him back! AvB cowers through the ropes, sneaking through and standing on the apron where he certainly cannot be attacked by his rule abiding opponent! AvB turns around to crotch chop at the crowd as Shane sneaks up behind him. HE WRAPS HIS ARMS AROUND THE UNSUSPECTING AVB! THE LOCKEDOWN IS SLAPPED ON!
Unjoo Park: SHANE'S GOT THE LOCKEDOWN ON! SHAKE LOCKE HAS SLAPPED HIS PATENTED CHOKE ON YOUR GRACE AND LIFTED HIM CLEAN OVER THE ROPES AND INTO THE RING!
Oliver Wright: Blankenships's in trouble, Alex is on the verge of losing in his debut! Wait, look look look!
AVB POWERS OUT OF THE LOCKEDOWN! SHANE LOCKE IS ABSOLUTELY FLABBERGASTED AS AVB TAKES FULL ADVANTAGE, RUNNING THE ROPES. BAPTISM! SHANE LOCKE IS OUT LIGHT A LIGHT! IT'S ALL BUT OVER WHEN DAVENPORT SLIDES IN AND COUNTS THE THREE!
Walter Stanford: The winner of this match via pinfall, "ALWAYS VERY BLESSED" ALEXANDER VON BLANKENSHIP!
Unjoo Park: I told you! von Blankenship has what it takes and in his second match he scores the win over a seasoned talent such as Shane Locke.
Oliver Wright: Never trust the blood of a Rat Bastard.
Stanford: The following contest is a Submission Match for the Wildfire Championship! Introducing first, the challenger, from Houston, Texas, weighing in at 160 pounds, they are SAAAAAAAAAM SAWWWWWWYEEERRRRRRR!
The arena lights dim as a bassline begins to play. While a silver mist slowly fills the stage, the fans wait in anticipation. A deep voice starts singing in a whisper. Then, a dark figure walks through the mist. Completely decked out in black, the teenager slowly walks forward. The camera mostly keeps its distance. Different angles give a better look, but their face is still mostly obscured in darkness. After climbing the steps and entering the ring, the volume of the music increases.
"I hear the sons of the city and dispossessed
Get down, get undressed
Get pretty but you and me
We got the kingdom, we got the key
We got the empire, now as then
We don't doubt, we don't take direction"
The mist has thinned but the arena is still dark. The song quietens down
"Lucretia, my reflection, dance the ghost with me"
Then reaches its loud finale. The lights come back on to reveal Sam Sawyer standing in the ring, the camera focusing on their vacant face.
Park: Sam Sawyer heading to the ring for their shot at the Wildfire Championship! We’ve seen a lot of sides of Sawyer recently, especially after a brutal attack on the champion that put Zolothach on the shelf. The former X-Crown contender gets a chance at finally winning their first title here tonight.
Stanford: And their opponent… from Paris, Illinois, weighing in at 165 pounds, she is the Wildfire Champion, she is ZOLOTHAAAAAAACHHHHHH!
“Cthulhu” by Gunship begins playing as torches all along the entranceway and aisle light up. “Zolothach” Tabitha Osborne walks out from the back with a wide grin as she takes in the boos from the crowd. She heads down to the ring with a sexy swagger (but she looks like a corpse so not very many catcalls). She rolls into the ring and leans in her corner.
Wright:[ The champion doesn't look worried at all.
Park: Submission match with high stakes right here, Wright.
The ref calls for the bell, and the pair square up in the center of the ring, oving in a slow circle back and forth before locking up in the center of the ring. A quick back and forth, and Sawyer pushes Zolothach to the corner.
The ref calls for the break, and Sawyer back off willingly. Zolothach comes out swinging, pushing past the ref to start firing off punches. Sawyer steps back, covering up before they drive a stiff kick into Zolothach's stomach!
Wright: A nasty blow from the challenger!
Park: The champ trying to go toe to toe with one of the best strikers in Fireside was a gamble for sure there.
Sawyer nails a quick DDT, and the fans cheer as they grab Zolothach's legs to roll her over, stomping away on her knee before locking on the Sawyer Lock!
Park: Sawyer Lock locked in! This could be it already!
Wright: Zolothach claws for the ropes, reaching out for them desperately! The challenger got the champion sleepwalking!
Zolothach yells out in pain as the hold is applied tightly. The referee asks if they would like to submit, and she would shake her head no if she wasn’t painfully locked in a hold by Sawyer. Zolothach even bites down on Sam’s fingers, but Sam still keeps the hold applied!
Park: Sawyer and Zolothach are close to the ropes, but Zolothach’s first instinct was to bite their fingers off!
Wright: That’s her crazed mind for you! Zolothach just needs to reach out here!
Zolothach manages to reach out and grab the bottom rope!
Wright: Rope break! The adrenaline of trying to get in and win as fast as possible, flowing through Sam’s veins there as they were a bit too close to the ropes. Sam’s gotta concentrate and slow it down.
Park: The early damage could come back to help Sam though, that hold is one of the most painful in all of wrestling to get trapped in.
The ref calls for the break, and Sawyer breaks the hold with a shake of their head. They seem a little listless as they step back, and Zolothach pulls herself up the ropes as she shakes out her leg with a frown.
Sawyer comes charging in, and Zolothach ducks low to toss her over the top rope! The fans boo, and Sawyer comes up on the outside only to be caught by a dive between the ropes from Zolothach!
Wright: The champion roars back with a big dive!
Park: She’s not going down without a fight!
Zolothach comes back, yelling at the jeering fans before she spins around to glare at Sawyer. The challenger flinches back, shaking their head as Zolothach charges in with a thrust kick that sends Sawyer against the barricade! The fans boo, and Sawyer shakes their head before Zolothach delivers a few brutal looking chops.
Park: Taking some real punishment from Zolothach on the outside!
Wright: Zolotahch is going to town with these chops!
Zololthach grabs Sawyer by the small hair they have, driving a few stiff punches into their face before she drags them over to the apron. A quick smash of their head against the ring, and the fans boo as Zolothach goes for another!
But Sawyer breaks free, and Zolothach gets her face smacked into the apron. Sawyer shakes their head, jerking her upwards to do it again! The fans cheer, and Zolothach is shoved back to the inside.
Wright: The champ is in trouble!
Park: Sawyer is climbing the ropes, it looks like they have malice on their minds!
The fans explode as Sawyer crashes down on Zolothach, and comes to their feet with a snarl. The Wildfire Champion is in a heap, and then Sawyer stalks in to grab at her. But Zolothach grabs their hand, twisting as she locks onto their fingers.
Wright: Sawyersault!
Park: Sawyer hit the Sawyersault and immediately looked for the Sawyersault, but Zolothach got ‘em!
Sawyer shakes their head as Zolothach rolls to her knees, still twisting!
SNAP!
Wright: UGH! Look at that finger! Zolothach just broke one of Sam’s fingers with impressive strength!
Park: Big yikes for the challenger, and the champion’s not done! This is the payback the champ has been looking to inflict!
Sawyer looks stricken, almost in dread as Zolothach spreads their fingers with an evil smile.
Wright: She is going to break even more their fingers! This is uncalled for!
Park: It's a submission match, Wright! This is revenge! Anything goes!
Zolothach starts to rise, finally snapping another finger!
SNAP!
The pain makes Sawyer stagger back holding their hand with a horrified look at the champion. Zolothach smirks, grabbing them around the waist with a look of triumph!
But Sawyer rolls around behind her, and Saito Suplex!
Park: These fans are on their feet as Zolothach goes down again! The challenger is back in this fight!
Wright: Zolothach is back on her feet, screaming for more!
Sawyer blinks, and then hits a huge throat chop! Zolothach staggers back a step, then shakes her head wildly as she comes back in still screaming! And another huge thrust to the throat that just drives Zolothach back a step, her head shaking as she seems to not notice the attacks!
Wright: Unbelievable!
Sawyer glares, shaking their head angrily before they hit the Fire with Fire! And another as Zolothach rises! The champion is down, and the fans are going wild as Sawyer again climbs the ropes!
Wright: SAWYERSAULT!
Park: No! Zolothach got a knee up!
Zolothach gets the knee up as Sawyer crashes down hard, then wastes no time grabbing Sawyer to twist their arm around for a chickenwing!
Park: The champion is still in this!
Wright: Sawyer’s not tapping out! They are looking for the ropes!
Park: The champ tightens the hold!
And Sawyer gets a foot on the rope, the ref calls for the break! But Zolothach holds onto the four, breaking the hold as Sawyer once more looking listless shakes out their arm before coming back to their feet.
Zolothach throws a punch, but Sawyer flings her into the corner. Driving her head into the turnbuckle a few times before she drags her off, hitting a huge DDT! The fans cheer, and Zolothach looks out again.
Sawyer shakes their head, and drags her towards the center of the ring!
Park: Sawyer going for the ring position! Trying to keep the champion away from the ropes!
Wright: This could be giving the champ time to recover, Park! I am not sure it is going to pay off!
Park: Sawyerlock! Sawyerlock!
The fans are on their feet, cheering as Zolothach claws at the mat. She tries to break away, pushing herself towards the ropes. She tries to grab at the ref, but he jerks away as Zolothach looks to be fading!
Park: This could be it! Could we be about to see a new champion?
Wright: Zolothach taps! The champion is tapping to the Sawyer Lock! New champ!
Stanford: Here is your winner, and the NEEEWWW WILDFIRE CHAMPION, SAAAMMMM SAWYYYERRRR!
Wright: We have a new Wildfire Champion to kick off Fuel for the Fire!
Park: Zolothach seemed to be on a mission to break as many bones of Sawyer’s as possible, but in the end the challenger simply wouldn’t be denied!
Sam Sawyer releases the hold and quickly receives their first championship in FIRESIDE. For maybe the first time, we see pieces of a reaction that isn’t completely stoic as the new champ holds up the belt high above their head to a round of cheers from the crowd.
Wright: If you keep pushing and working harder than your competition, eventually things will fall into place for you!
Park: I look forward to seeing what the champ does with their reign![/font]
Stanford: The following triple threat match is scheduled for one fall, and it will determine the new FIRESIDE SPARK Champion!
The fans cheer.
Stanford: Introducing first, from Pittsburgh, Pennsylvania, weighing in at 215 pounds, he is DOOOOOOOONNNNNZZZIIIIIIIGGGG!
The light go down, and then come up an angry red. Flames explode from the eithr side of the ramp, jets and bursts of flame erupting into the air. Sinclair Godfrey steps out first, lifting her arms before Donzig walks from the back, wearing his skull mask with his hood up. He pauses, glaring out across the crowd before he shakes his head before walking down the ramp slowly. He circles around the ring, still watching the crowd before pausing to watch the announce team before he climbs the stairs. He stops at the ropes, reaching up to shove his hood back before stepping through the ropes. Then he takes off the mask, and shakes his head at the fans with a scowl before he leans back in his corner. Arms resting on the ropes while waiting for the match to start.
Wright: What a terrifying individual Donzig is. He seems to have a grudge against half of FIRESIDE's roster. How much does he actually care about the SPARK Championship?
Park: I'm not sure, Ollie, but he looks like he needs it. And whatever his motives are, he hasn't been pinned or submitted in FIRESIDE. He was a finalist in last year's End of Days. He's the favorite for my money.
Wright: Donzig defeated one of his opponents tonight, Edward Zepp, to make it here. Not the cleanest of victories, but-
Park: Doesn't matter. Tonight there's no disqualifications.
Stanford: Introducing next, from Alsace-Lorraine, France, weighing in at 230 pounds, she is AAAAAAAAPPAATTTHHHHYYYYYYYY!
"I love you...now die"
The haunting distorted voice of SKYND fills the arena, red smoke billowing up from the stage as the lights go down, bathing the arena in a sea of red. Apathy emerges at the top of the ramp, rising from under it arms stretched out wide on either side. Her head tilted back looking up at the single red light beaming down on her, basking in the glow. As the bass kicks in she drops her arms and raises her head on time with the beat and makes her way to the ring.
Wright: I'm not sure if anyone can be the favorite when Apathy is in the match. She won The Kindling, defeating Zepp in the final, making it all the way to the World Championship match with Natalie Burrows: Apathy's only loss in FIRESIDE to date. And to make it here she had to defeat Hank Sokolov, which is no mean feat at all.
Park: Absolutely not. Apathy has impressed all of us and I'd love to be proven wrong. If Donzig or Zepp win this it's not gonna be easy.
Stanford: And finally, from San Diego, California, weighing in at 299 pounds, he is EDWAAAAAAARRDD ZEEEEEEEEEPPPPPPP!
The menacing synth and deliberate drums of "Blood Moon" by Dance With The Dead signals the arrival of Ed Zepp, who stalks toward the ring with a look of annoyance that's obvious even through his pair of dark sunglasses. He bounds up to the apron with one step and over the top rope with another, then briefly points a fist to the crowd around him.
Wright: There's a lot of controversy about Edward Zepp's appearance in this match. He lost to Donzig in his qualifying match, but somebody - we don't know who - made a deal to insert Zepp into the third qualifying match between Alexander Von Blankenship and Rebecca Brookes, which Zepp went on to win. In Zepp's defense though, Gavin Drake's distraction cost him the match with Donzig.
Park: Yeah, but that's not enough to suddenly get a second chance out of nowhere, is it?
Wright: Maybe not, but he's here now, and you'd be a fool to count him out. He's had some losses in big matches, but it was always close, and tonight we could easily see him finally win gold.
Park: Wouldn't surprise me at all.
The referee calls for the bell as the three competitors stand in their corners. Donzig stares at Zepp and Apathy with a cold expression, completely fearless.
Wright: Donzig isn't backing down. We all know the respect Zepp and Apathy have for each other. They teamed together in the Kindling semi-final, don't forget.
Park: Something tells me that's not going to count for much here.
Apathy suddenly starts to move, rapidly closing in on Donzig. Slightly surprised, Donzig steps up to meet her and hits a punch. The strike stuns Apathy, allowing Donzig to hit a second. Apathy hits back with a more powerful punch. Donzig is staggered but manages to quickly fire back with another punch. The two continue to exchange punches until Donzig stops Apathy in her tracks with an eye rake. He follows up with a barrage of punches that forces Apathy all the way back to the corner. He then smashes a stiff elbow into her face.
Park: What a shot!
Wright: Apathy is in trouble! And Zepp is just happy to watch!
Park: Why not?
Donzig takes a cautious look at Zepp, then runs to the opposite corner. He runs back at top speed towards Apathy and nails another elbow smash. Then he does the same thing again, but this time Apathy meets him with a big boot! Donzig doesn't leave his feet and seems to have absorbed the stiff blow well, but Apathy quickly follows up with a knife-edge chop. The crowd "woo" at the loud impact, and Apathy hits another one just as hard. The chops keep coming and Donzig is rocked as he's forced to keep stepping backwards. He tries to stop Apathy's momentum with a boot to the knee. Apathy's leg buckles but she immediately hits back with her loudest chop yet. Then she hits a huge European uppercut that sends Donzig stumbling away, barely on his feet.
Wright: Dear God, what an uppercut!
Park: Apathy is absolutely slaughtering Donzig right now!
Donzig ends up in the corner, facing away from Apathy with his head resting on the top buckle. He turns around just in time to see Apathy charging at him with a clothesline. The huge lariat leaves Donzig out on his feet, only held up by the corner. Apathy gives Zepp an intense stare of warning as she backs into the opposite corner from Donzig. She runs in for another clothesline but Donzig steps forward and ducks his head. He turns around and starts laying his fists into Apathy, now trapped in the corner. With a malevolent intensity he grabs her hand and pulls her into an Irish whip. Apathy reverses and sends Donzig's back into the opposite corner. Donzig is still laser focused on Apathy and after she stalks into the middle of the ring he launches himself at her with a lariat. Apathy doesn't budge and whips Donzig into the corner behind her, this time using her own momentum. Donzig's back cracks into the buckles much harder this time and he staggers out defenseless. He walks right into a fall away slam position. Apathy throws him over her head and he hits the mat hard and rolls out of the ring.
Park: Look out, here comes Zepp!
Zepp finally leaves his corner and is waiting for Apathy when she gets to her feet. He grabs her throat with both hands.
Wright: Psychomania!
Before Zepp can do anything, Apathy out of desperation starts kicking him in the leg. Zepp is frozen in place for a moment but suddenly uses both of his hands to lift her up, and swing her back hard into the turnbuckles, not letting go of her throat. Then he throws her over his head with the Psychomania! All the life seems knocked out of her and Zepp quickly closes in to hook the leg.
...ONE!
...TWO!
...KICKOUT!
Zepp doesn't let up and goes straight for the claw hold, squeezing Apathy's forehead!
Wright: Silent Scream!
Park: Apathy needs to watch her shoulders!
...ONE!
...TWO!
Apathy lifts a weak arm off the mat. She manages to keep it in the air but the life seems to be fading from her.
Wright: Here comes Donzig!
Donzig runs at kneeling Zepp and boots him in the side of the head. The blow is sickening but Zepp quickly rises to his feet. Donzig kicks him in the gut and grabs his head for the stunner but gets shoved away.
Wright: Event Horizon, no!
Donzig rebounds off the ropes and is big booted off his feet. Zepp grabs his neck and pulls him back up, then with a massive biel launches him over the top rope to the floor!
Park: Looks like Zepp has had enough of Donzig!
Wright: He has the SPARK title in his sights! Watch out, Apathy!
Zepp runs to the ropes and bounces back towards Apathy. He leaves his feet to hit a huge elbow drop. After landing the elbow he grabs her throat and lifts her up to her feet.
Wright: He's looking for the Mute Button! If he hits it, it's over!
Park: Donzig's on the apron!
Zepp lets go of the choke to run towards Donzig with a big boot. Donzig leaps backwards to avoid the boot. Zepp turns back to Apathy but is met with a shotgun dropkick that sends him through the ropes to the floor!
Wright: Where did that come from?!
Donzig swoops in on the downed Zepp to hammer him with clubbing blows to the back. After the last of furious shots he storms over to the commentary area and picks up a steel chair. He swings it down onto Zepp's back for a huge impact.
Wright: Donzig taking advantage of the triple threat rules!
Park: Look behind you, Donzig!
When he goes for a second swing Apathy rips the chair out of his hands from behind him. He turns around and she jabs him in the gut with it. Then she drops the chair, grabs Donzig's head and runs with him towards the barricade. She tries to throw him over it but he slams both hands onto the barricade to stop them both in their tracks. Donzig elbows Apathy in the gut to break her grip, then grabs her head and smashes it into the barricade! Apathy turns to face him, not looking happy about it, but Donzig starts punching away at her, trapping her against the barricade. When she seems almost done, he tries to finish her with a jumping knee uppercut. Her eyes are dazed but she doesn't leave her feet.
Wright: Apathy won't go down!
Her resilience only motivates Donzig as he takes a few quick steps back. He runs at her and tries to clothesline her over the barricade. When she doesn't go over, he jogs back and hits a second clotheline. She still doesn't budge. On the third attempt, he takes his longest run up yet and flies towards Apathy, only for her to throw him over her shoulder to the concrete on the other side!
Park: Whoa!
Wright: Donzig goes flying! Apathy survives!
Apathy barely has a chance to catch her breath before Zepp comes charging at her. He leaps with a diving shoulder block but Apathy dives out of the way! Zepp manages to steady himself on the barricade to stop himself crashing into it or going over it. He turns around to see Apathy rising to meet him. Apathy hits him with a huge right hand. Zepp hits back with a massive blow that should have sent her flying, but she stands tall and hits right back. The pace of the fistfight starts to intensify, along with the noise of the crowd.
Wright: Apathy and Zepp are showing absolutely no mercy! They look like they want to kill each other!
Park: I knew it was going to come to this!
Apathy's speed manages to make up for Zepp's power, but the latter eventually proves too much and Zepp gets in three hard uninterrupted shots. Afterwards he hits an open-hand uppercut that knocks her to the floor. She gets straight back up but only for Zepp to cover her face with a claw. Eyeing the commentary table behind her he lifts her up into the air.
Wright: The Re-Animator!
Park: No!
Apathy lands on her feet behind him. She chickenwings his arms then throws him over her head with a tiger suplex!
Wright: What the...?!
Apathy holds on and lifts him back to his feet. She looks around her, adjusts her position, then hits a dragon suplex onto the steel chair!
Wright: Dragon on the chair!
Park: Zepp hit his head hard! He's out!
With a relentless look in her eyes, Apathy grabs Zepp and tries to prop him up off the floor. Just as she manages to Donzig clatters into her and crushes her against the ring apron. He grabs her hand and short arm clotheslines her to the floor. He keeps his grip and lifts her up, turns to face the ring and hits another short arm clotheline, causing the back of Apathy's head to hit the apron.
Park: Yikes.
Wright: That didn't look good.
Donzig throws Apathy into the ring then slides in himself. He stalks her as she gets to her feet, then runs in to hit a swinging neckbreaker. She lands in a perfect position for Donzig to spring off the ropes with the lionsault!
...ONE!
...TWO!
...KICKOUT!
Only seconds after Donzig breaks the cover, Apathy starts to get back up. Donzig looks surprised by this, but when she's up he's ready to land a stiff elbow smash. He hits a second elbow smash, then kicks her in the gut.
Wright: Event Horizon!
Apathy shoves him away powerfully, sending him into the ropes. When he comes back he ducks her clothesline. He hits the ropes and ducks a second clothesline, hit the ropes, then goes running right into a roaring headbutt!
Wright: Headbutt!
Park: That was some sick impact. How is he on his feet?
Donzig is wide open and Apathy pulls him closer to the corner, then hits a snap suplex into the turnbuckles! Then she pulls him to his feet and puts him in a death valley driver position. She hits the DQD, the back of Donzig's head striking her knee!
Wright: Dynast Queen Driver!
She hooks Donzig's leg.
...ONE!
...TWO!
...KICKOUT!
Undeterred, Apathy drags Donzig back upright and and locks his head in position for a futureshock DDT.
Wright: Death Before Dishonor?!
She leaps back and hits it! She hooks the leg.
...ONE!
...TWO!
...NO!
Zepp had crawled into the ring just in time to grab her leg and pull her off of Donzig! He drags her all of the way across the mat to the floor outside. Zepp puts a claw over her face, lifts her up and puts her through the commentary table!
Park: NO!
Wright: The Re-Animator through the table!
Park: She had Donzig beat!
Remorseless, Zepp climbs into the ring under the bottom rope but as he does Donzig rolls out the other side. Donzig uses the last of his energy to crawl as far as he can up the entrance aisle.
Park: Donzig is doing whatever it takes to survive! He knows he's wide open if Zepp gets his hands on him!
Wright: Now Zepp's coming back for Apathy!
Zepp lifts Apathy off of the table and rolls her into the ring. He climbs in after her.
Park: Donzig's coming back!
Halfway to the ring Donzig's legs collapse.
...ONE!
...TWO!
...KICKOUT!
Wright: No! Apathy's still in it!
Park: Un-freaking-believable! Let's go Apathy!
Zepp grabs Apathy by her throat and pulls her up. Donzig manages to climb in the ring with Zepp about to hit the Mute Button. Zepp doesn't see Donzig, allowing Donzig to grab his arms and spin him into position for the unprettier, letting Apathy fall to the mat.
Wright: 25:17! Can he get it?!
Zepp pushes Donzig away, sending him hurtling into the ropes. Donzig grips the top rope tightly to avoid going over. Zepp runs at him and goes for a diving shoulder block but Donzig ducks. It's Zepp's turn to crash into the ropes, and he also narrowly avoids falling out of the ring. Zepp turns around and is kicked in the gut, then hit with the Event Horizon! Donzig hooks his leg as Apathy is nearly back to her feet.
...ONE!
...TWO!
...THREE!
Stanford: Here is your winner, and the NNNNEEEEEEEWWWWWWWWW FIRESIDE SPARK CHAMPIOOOOONNNNN, DOOOOOOOOOONNNNNNZZZZIIIIIIIIGGGG!
Donzig gets up and is surprised to see Apathy there, glaring at him. The referee hands him the SPARK Championship. He takes it but doesn't look at it, not taking his eyes off of Apathy. He begins to grin cruelly, as if taking pleasure in Apathy's loss, then turns his back on her and leaves the ring.
Wright: It's a shame for it to end like that for Apathy, after coming so close, but I guess congratulations go to Donzig.
Park: You better get used to it, Ollie. I wouldn't bet against Donzig taking the SPARK title all the way to a World title shot.
Wright: You might be right, but I don't think we've heard the last of Apathy or Zepp. It'll be interesting to see how things go from here.
Stanford: The following contest is our co-main event and is a Workhorse match scheduled for thirty minutes! Introducing first, from Daytona Beach, Florida, and weighing in at two hundred and thirty pounds, he is the former SPARK Champion, he is the Heart of Fireside…. VODKA FIIIIIIIZZZZZ!!!
The lights go down and blacklights come up, bathing the stage in purple. A hard, grungy bassline starts to play.
'Hey, turn the bass up. Turn the bass up!'
There is a record scratch, and the grungy beat changes to a hard dubstep rhythm. The lyrics come in as Vodka Fizz dives out on stage in a golf cart retrofitted with huge speakers that are playing his music. He is dressed in a full-length white fur coat, white shutter glasses, and an over-the-top white top hat, and as he drives the golf cart down the ramp he toasts fans with a yard-long cocktail flask hung around his neck full of some fluorescent liquid he drinks from as he drives down the ramp..
When he gets to ringside, he drapes the fur coat over the seat of the golf cart and removes the top hat, keeping the shades on. He climbs up on the apron, turning to face the crowd and chugging the remnants of his large drink, finally striking a pose and spraying a mouthful of whatever it is up into the air and letting it rain over him. He grins and winks at the camera, then rolls backwards over the ropes into the ring.
Park: Vodka Fizz has really sold what winning the match means to him.
Wright: I can’t imagine a better matchup for our main event. Both of these two have to win, so there’s no way this isn’t going to be incredible.
Park: My money’s on Burrows, she always delivers, and she still has a score to settle with MAJESTY.
Wright: We’ll see how this whole thing turns out. One thing is for certain, it’s sure to be riveting.
Stanford: And his opponent, from Raleigh, North Carolina and weighing in at one hundred and sixty-five pounds, she is the longest reigning Fireside World Champion, NATALIE BUUUUUUURROOOOOOOWS!!!
I can finally breathe again.
The distorted opening lyrics of 'Breathe Again' plays as the overhead lights dim, the sequence of notes following it triggering coral-colored lights to pulse in time... and when the guitars and drums combine to form an explosion of noise? Every light in the arena as well as the tron goes blinding white--and when it fades back to normal a few seconds later? Natalie Burrows is standing at the top of the ramp, the crowd cheering for the Southern Belle as she looks out over the fans with the FIRESIDE World Championship around her waist. A nod of acknowledgement is given. As video footage plays of some of her hardest-hitting moments in the ring, Natalie makes her way down to the ring, slapping the hands of the fans here and there, but her focus is on the ring. Speeding up at the bottom of the ramp, the Southern Belle slides into the ring, rolling onto her back before kipping up to her feet. The nearest turnbuckle is mounted as she looks out over the crowd, removing the title and holding it aloft with one hand to evoke more cheers. She lingers there for a few moments before hopping down, turning the FIRESIDE World Championship over to a P.A. before doing a couple stretches to prepare for the match at hand.
Wright: Burrows has been adamant that she’s going to retain this championship.
Park: Not to mention the fact that Fizz hurt her by being a dickhead.
Wright:No matter the circumstances, these two have a fight ahead of them.
Park: I’m excited to see how this all plays out.
Fizz and Burrows square off in the ring. The pair stare each other down, until Burrows offers her hand to shake, which Fizz does. The referee calls for the bell. Fizz and Burrows tie-up collar and elbow. Fizz strongarms Burrows into a headlock, but Burrows drives sharp elbows into his ribs, clinching around Fizz’s waist and countering with a waistlock suplex. Fizz lands on his feet and fires a knee at the back of Burrows’ head, but the champ ducks and responds with a pump kick to the challenger. Fizz stumbles forward into a handspring, going for an early attempt at Uno Mas, but Burrows counters it into a brutal slam into the mat.
Wright: Good lord!
Park: Nice counter to that handspring stunner, but, like, ow dude.
Burrows rolls Fizz over and grabs his ankle, cinching in an ankle lock. Fizz scrambles to grab the ropes, but Burrows pulls him back to the center of the ring, planting a foot between his knees so she can exert force on his knee, too. Fizz howls in pain, scrabbling at the mat to try and get any sort of purchase so he can get to the ropes, but the challenger fails to make any headway.
Wright: Burrows has Fizz trapped!
Park: It looks like our boy Voddy may have no choice but to tap. Shame to see him giving up the advantage to Burrows so early in the match.
Fizz clenches his fists and tries again to get to the ropes, but Burrows has him handily locked down. Fizz starts to rock from side to side, managing to roll onto his back, and he plants his feet to launch Burrows into the ropes. She bounces off the ropes and Fizz rolls her up in a small package!
..ONE!
..TWO!
..Kickout!
Wright: After an impressive escape from Fizz, he almost turned it around and took the advantage himself!
Park: But he can’t have done his ankle or his knee any good.
Burrows is quick to her feet and Vodka is holding his knee, laying on the mat. Burrows grabs the challenger’s wrist, driving a kick into Fizz’s shoulder and locking in an Armbar, but Fizz immediately forces the break by hooking his arm around the bottom rope. The ref starts a five count and Burrows immediately releases Fizz and moves away, watching as he uses the ropes to pull himself to his feet. He tries to take a step and it looks like his knee is going to give out, but he stomps his foot a couple of times then limps toward the center of the ring.
Park: No back down in Vodka Fizz!
Wright: There’s a reason they call him the Heart of Fireside, UnJoo!
Fizz and Burrows tie up again. This time. Burrows kicks Fizz in the inside of the thigh. The challenger comes back with a kick of his own. Then another kick from Burrows, and another kick from Fizz. Burrows comes in with a kick to the other thigh and Fizz’s breaks away, but Burrows maintains a wrist lock, using it to judo throw Fizz over her shoulder to the mat and follow it up with a knee to the back of the challenger’s head. Burrows grabs Fizz around the waist, hauling him up to his feet and nailing a German Suplex, rolling through into a bridging pin attempt!
..ONE!!
..TWO!!
..TH-Kickout!
Wright: That was the closest one yet!
Park: So far this match has been very one sided. Burrows’ offense is on point.
Fizz uses the ropes to pull himself to his feet again. Burrows presses her track, charging at him for a big boot, but Fizz drops down and Burrows tumbles over the ropes onto the apron, but she manages to stay on her feet and avoid falling off by grabbing the top rope. Fizz hurls himself into the opposite ropes and launches himself at the champion, who counters with a kick to the face. Fizz staggers, but stays on his feet. Fizz launches himself into the ropes again, and is once again rewarded with another kick to the face. The challenger looks perplexed, but he still manages to stay on his feet, barely. He launches himself at the ropes a third time and this time he’s met by Burrows using the ropes as a springboard to nail the leaping leg lariat!
Wright: Denial from the champion! What a beauty of a move!
Park: Desperate times, Ollie! If that doesn’t give us a pinfall, I honestly don’t know what will!
Burrows goes for the cover!
..ONE!!
..TWO!!
..THREE!!!
The bell rings a single peal!
Wright: The first pinfall goes to Natalie Burrows at about the seven minute mark!
Park: That has to be disheartening for Fizz.
The referee tries to check on Fizz, who shoos the official away, fighting his way back to his feet. For her part, the champion lets him get to his feet. Fizz leans against the turnbuckle for a moment, but before he has much of a chance to so much as catch his breath, Borrows comes in to the corner throwing haymakers. Fizz comes back with blows of his own, but it seems like the champion has the better of the challenger. Burrows hooks Fizz up for a belly-to-belly suplex, but Fizz manages to land on his feet again. Fizz launches himself into the ropes, hitting a handspring and coming back to catch Burrows with Uno Mas!
Wright: Uno Mas from the challenger!
Park: It looks like Fizz might just be back in this thing!
Fizz goes for the cover!
..ONE!!
..TWO!!
..Kickout!!
Park: Burrows got rocked, but it wasn’t enough to put the champ down!
Wright: Say what you like about Natalie Burrows, she has a reason to hold onto that belt, and the heart of Fireside isn’t going to have an easy time taking it from the Southern Belle.
Fizz hauls Burrows up off the mat. He tries to tie up the champion again, but Burrows catches him with a straight right hand. Burrows tries to whip Burrows into the ropes, but Fizz reverses and throws Burrows instead. He sets up for a spinebuster, but Burrows rolls through and reverses into a sunset flip powerbomb! Burrows goes for the cover!
..ONE!!
..TWO!!
..Kickout!!
Park: Burrows is doing a great job keeping the pressure on!
Wright: Vodka Fizz may just be paying the price for his hubris.
Buth competitors are quick to their feet. Burrows is a little slower than Fizz is, and the challenger takes that opportunity to dropkick Burrows into the turnbuckle. He ties up with her in the corner, rolling backward to monkey flip her into the center of the ring, then vaults up onto the top turnbuckle. He launches himself across the ring and nails the Fireside World Champion with an elbow drop!
Wright: It looks like Fizz might just have gotten things started!
Park: If he keeps this up, the second half of this match is anyone’s game!
Fizz goes for the cover!
..ONE!!
…Kickout!!
Park: …And an authoritative kickout from our world champion!
Wright: I’m sure that Fizz expected no less!
Fizz looks a little disappointed. Burrows rolls onto her stomach so Fizz can’t go for another pin, so instead he tries to hook up a crossface, but Burrows drives elbows into his midsection, forcing the challenger to abandon the attempt. Fizz clinches Burrows by the waist, hauling her up to her feet, and then punches her in the back. Fizz goes for a Belly to Back Suplex, but Burrows lands back on her feet. Fizz turns around to catch a shotgun dropkick back from Burrows. Burrows comes in for the Shining Wizard, but Fizz sidesteps her and feeds her into the turnbuckle. Fizz grabs burrows from behind, but she smashes his face with elbows until he lets go. Burrows hooks Fizz up for a Dragon Suplex and suplexes him into the corner. Burrows crouches down, watching Fizz as he starts to get to his feet. Fizz gets up to his knees and Burrows launches herself at the challenger, aiming for the Axe kick, but he rolls forward and she misses, landing awkwardly, and Fizz takes advantage to catch her in the Flying Octopus hold!
Park: Hanging Chad!
Wright: And considering the pace in the early moments of this match, that two hundred and twenty pounds might as well be a thousand!
Park: Fizz’ll tie it up if the champ taps here!
Burrows tries to fight through the move, but Fizz’ll have none of it. He cranks her arm back, both he and the champion straining. Burrows starts to sag under the move, and then finally nods, and the ref calls for the bell, which rings a single peal!
Wright: And we are tied!
Park: One-One at the 15 minute mark. Fifteen minutes to go!
Wright: And it seems like these two have a lot of fight left!
Fizz lets Burrows out of the hold. The referee checks on her, and Fizz keeps his distance, observing the champion. When she waves away the referee, he approaches for a tie up, but she drives a kick to his knee, then smashes an elbow into his face. Burrows hooks Fizz up on a rear naked choke, but Fizz grabs the ropes and forces the break. Burrows complies, and Fizz rolls out of the ring. The referee starts counting.
ONE!
Fizz takes the chance to catch his breath, but Burrows doesn;t give him much of a reprieve before she comes at him with a baseball slide that the challenger barely manages to avoid.
TWO!
Burrows lands on her feet, and Fizz grabs her from behind for a belly-to-back Suplex. Burrows lands on her feet again, then ties up with Fizz from behind, firing off a belly-to-back suplex of her own. Fizz lands on his feet.
THREE!
Fizz locked in another waistlock, but this time, Burrows drives back elbows into his face. Fizz breaks the hold.
FOUR!
Burrows hooks Fizz up for a belly-to-belly suplex, but Fizz fights it, trying to counter with one of his own. It is eventually Burrows that gets the better of Fizz, and she suplexes hom into the hard floor. Burrows hauls Fizz up off the floor and rolls him into the ring. She climbs up onto the apron, only to get speared off by Fizz and both crash to the floor. The referee restarts the count.
Wright: Burrows certainly didn’t expect that tackle.
Park: It doesn;t look like Fizz is in any position to capitalize!
Wright: If either one of the competitors gets counted out, it’ll count as a pinfall for the other, so if one of them can get back in the ring sooner than the other, it’s a legitimate tactic.
The referee is at a five count before either competitor starts to stir. Burrows gets to her knees and crawls over to the ring as the referee continues to count. She uses the apron to pull herself up just as Fizz starts to get to his feet as well. Burrows rolls into the apron at the eight count. Fizz manages to get to his feet at nine and dashes to the ring, sliding under the ropes to just beat the ten count!
Park: Fizz beats the ten count!
Wright: But Burrows is waiting for him!
He is rewarded for his last minute entry, however, with a hard heel driving down into the base of his skull.
Wright: CLOSURE!
Park: Well, say goodnight, Voddy.
Burrows goes for the pin!
..ONE!!
..TWO!!
..THREE!!
The bell rings another single peal.
Wright: And the champion takes it to 2-1 at twenty minutes!
Park: It’s still anybody’s game, though. Ten minutes is a long time.
Fizz rolls out of the ring to catch his breath. He walks around the ring, breathing heavily. He take a moment to catch his breath while the referee counts. He climbs up on the aron and Burrows is immediately in the challenger’s face, peppering him with blows. She hits him with a jawbreaker, but Fizz manages to stay on the apron by holding onto the top rope. Burrows gras Fizz around the waist and suplexes him into the ring. Fizz handsprings into the rope, aiming for another uno Mas, but Burrows catches with a spinning backfist, stopping the challenger cold.
Park: Burrows is really putting in the work here to prove why she’s the longest reigning Fireside champion!
Wright: There’s still time for Fizz to come back, and if we’ve learned anything it’s to never count out Vodka Fizz.
Burrows goes for a pin, but Fizz reverses it into a small package that Burrows kicks out of it immediately. Fizz kips up to his feet and trades haymakers with Burrows. The pace of the match is starting to take it’s toll on both competitors so each subsequent hit takes longer and longer. Burrows rocks Fizz with a stiff elbow, followed up by a pump kick.Fizz bounces off the ropes and Burrows drives a kick into Fizz’s abdomen, setting him up for a piledriver. It looks like Fizz is going to fight through it and reverse the move into a waterwheel slam, but Burrows reverses it into a Destroyer!
Wright: Destroyer from the champion!,
Park: All she has to do is hold out for a couple more minutes and Natalie Burrows retains the championship.
Burrows hauls Fizz up from the mat. She tries to whip him into the ropes, but Fizz tries to reverse it into a ripcord clothesline, which the champion ducks. He comes back with a back elbow that hits its mark, then hooks up for the Mind Eraser!
Park: Here it comes!
Wright: Fizz has the champ in position for the Mind Eraser!
Before Fizz can hit the move, Burrows shoves him into the ropes, aiming to counter with the Rydeen Bomb, but Fizz counters again with a brutal DDT. Fizz kips up to his feet, then crouches in the corner, waiting for Burrows to get back up. He claps along with the fans to encourage her while she struggles her way to her feet, and when she is up, her reward is a shoulder jawbreaker, a boot to the guts, and a Mind Eraser!
Wright: That one struck true!
Park: We have less than five minutes to go, this is getting tight! If Fizz can get a pin here, we may be looking at going into overtime!
Fizz goes for the pin!
..ONE!!
..TWO!!
..THREE!!
The bell rings a solitary shime, and Fizz all but collapses to the mat, looking completely exhausted.
Wright: And with that, the champion and the challenger are tied at 2 and 2!
Park: These two have been going hard for twenty five minutes, and no matter how it ends nobody can say they didn’t give it their all.
Fizz eventually rolls over onto his hands and knees. Burrows is still not moving, so the challenger tries for another pinfall.
..ONE!!
..TWO!!
..Kickout!!
Wright: Looks like there are still some signs of life from Natalie Burrows!
Park: If Fizz had hooked the leg, he probably would have got that pinfall.
Fizz struggles back to his feet with a grin on his face. He manages to stay upright, though he’s clearly been brutalized and he’s sweating heavily. Burrows is in a similar state, but she uses the ropes to pull herself to her feet. Both competitors charge at each other and they start trading chops back and forth. Unlike before when they seem to be losing steam, now the pair appear to be feeding off each other’s energy, each chop coming harder and faster than the last. Fizz manages to get the advantage, and he hooks burrows up for a release German suplex. Burrows lands on her feet and grabs Fizz from behind, firing off a German suplex of her own, and Fizz similarly lands on his feet.
Park: Where is this energy coming from?
Wright: I don’t know, UnJoo, but if it keeps up these last couple minutes are going to be moments to remember!
Fizz and borrows run at each other and take each other out with running lariats. Both kip up to their feet, and they stare down each other for a moment, before they both run into the ropes again. Burrows comes in with a handspring elbow and Fizz counters it perfectly with the handspring stunner!
Wright: UNO MAS!
Park: We’re in the endgame now! We’ve got just over a minute to go!
Burrows stumbles back into the ropes, but manages to stay on her feet! Burrows launches herself at Fizz, but the challenger sidesteps her and hooks her up for the Hair Of The Dog What Bit Ya!
Park: Fizz gets in with the chicken wing!
Wright: This was how he beat Burrows the last time!
Park: Burrows only has to hold out for 40 more seconds for us to go to overtime!
Fiss locks in the body scissors, but Burrows manages to stay upright at first. She takes a step toward the rope before her adrenaline wears off, and the champion and challenger crash to the mat. Fizz has the move cinched in, and Burrows can’t get any traction to get closer to the ropes. She resolutely refuses to give up as endless seconds tick on, drawing ever closer to the end.
Wright: Burrows only has to hold on for thirty more seconds and then she gets a break before we move on to sudden death!
Park: But she’s fading fast, Ollie!
Burrows continues to struggle, trying to find some way to break the hold, but it seems like she’s done for. Burrows plants her feet and rolls Fizz onto his back, but Fizz rolls through, trapping the champion!
Park: There are seconds left on the clock!
Wright: We are so close!
Burrows struggles valiantly, but the lack of oxygen gets the better of her, and the champion goes limp. The referee lifts her hand and it drops, and the ref calls for the bell! It rings a single time, and then two more times!
Wright: Vodka Fizz beats the clock to become the new Fireside Champion!!
Park: 3-2 for Vodka Fizz!! That was a hell of a match!
Fizz and Burrows are both basically out. The ring crew is checking on both of them. Fizz is the first to his feet, holding an ice pack he’s been given over his eye as he goes to check on Burrows, who is similarly being checked on by the ring crew. He helps her up to her feet, and the two of them share a hug to a huge pop from the crowd.
Park: Aw, that’s kind of adorable.
Wright: Nice to know their bond is stronger than a match.
Stanford: The winner of this match with three pinfalls and the NEW Fireside World Champion…. VODKAAAAAA FIIIIIIIIZZZZZ!!!
The referee comes in with the title belt and Burrows stops him, taking the Fireside World Championship. She hugs it to her chest for a moment, looking distraught, before she hands the belt to Vodka. She raises his hand in victory, and Vodka raises the belt with his other hand, basking in the cheers from the crowd. Him and Natalie share another hug, and they leave the ring together, their hands interlaced as they slowly make their way up the ramp.
Electricity buzzes in the Spanish space as a cell structure begins being dramatically lowered. A team of technicians slide into the ring and begin to wrap the turnbuckles in what could best be described as a briar patch of barbed wire. If someone gets whipped into the turnbuckles, it’s going to hurt like hell.
Stanford: The following contest is your main event, and it is for the FIRESIDE Tag Team Championships…
The crowd cheers, knowing they’re about to get louder in about ten seconds.
Stanford: …and it is RAAAAAAAGEEEEEEEE IN A CCCCCCCCCAAAAAAAAAAGGGGGGGGEEEEEEEEEE!
There it is, one of the loudest pops of the night.
Wright: I’m excited! Get pumped, UnJoo!
Park: If I were any more pumped you’d have to charge $6 a gallon for me!
Stanford: In this match, once both members of your team have gone through a FLAMING table, the team is ELLIIIIMINAAAAAATEDDDD! The last team standing is your FIRESIDE Tag Team champions!
The crowd somehow gets louder!
Wright: If you and your partner go through a flaming table, you’re both eliminated. Put your opponents through, don’t go through yourself.
Park: I believe they’re still able to kick around ringside, but good luck doing that when you’ve just had your flesh seared!
Wright: This is a dangerous, dangerous match. Don’ try this at home folks. Careers will be shortened here tonight. We still haven’t seen Esmur ever since his face was lit on fire, I don’t know what will happen with these six competitors here tonight.
Stanford: Introducing at this time… the personal ring announcer to Evan Valentine, Greg the Assistant!
The man, the myth, the very much not-a-legend has firmly positioned himself outside of the cage to do his announcement.
Greg, the Assistant: Ladies and gentlemen, welcome to Fuel to the Fire! Regardless of its placement on tonight’s card, this is your Main Event of the evening! It is a Rage in the Cage match for the Fireside Tag Team Championships!
Wright: He literally just said that.
Park: I’m not sure our Spanish fans know what’s being said regardless!
A spotlight hits the entrance ramp where some turntables are sitting that say “DJ Nazz T” across Lance Valentine Jr. walks out to the loud boos of the crowd.
Wright: What is Lance doing out here?
Park: Yeah, doesn’t Evan’s cat need to be walked?
Lance Valentine Jr. steps up to the turntables, and starts playing the gothic metal intro to Dylan Black’s ring music “Blood, Tears, Dust’” by Lacuna Coil right when it gets to the chorus, he samples Evan’s theme “Gucci Gucci” by Kreayshawn. When that drops, the crowd jump to their feet and boo as Evan Valentine Jr. walks out with Dylan Black shaking his head behind him. They’re wearing matching “New Appendages” ring jackets. Lance cuts it back to Lacuna Coil with Kreayshawn’s track underneath.
Park: You gotta hand it to DJ Nazz T. These are not easy songs to blend. But he is somehow making them worse.
Dylan Black stands atop the stage, slowly raising his hand to taunt the crowd. New Appendages stand as a flash of light illuminates the stage as the rest of the arena is cast in darkness. Almost as if the very gods themselves are announcing their arrival. As they make their way down to the ring, Evan Valentine Jr. waves his hands in the air, keeping beat with the song, while Dylan Black ducks a full cup of Pepsi aimed at Evan’s head. Dylan steps into the cage and leans against the ropes, while Evan Valentine Jr. jumps to top turnbuckle and sits on top of it. Evan throws up the “E.V.” hand sign as the arena rocks with boos
Greg, The Assistant: Featuring first, from The City of Champions…
Spain boos at the mention of Boston. Dylan Black sneers as the chants of “Boston Sucks!” ring out, as Boston sucks so badly that even the Spaniards know about it.
Greg, The Assistant: Boston, Massachusetts! He weighs 218 pounds, He is The One Armed Bandit, The Former Babyface With The Special Parking Space, The Daemon of Mayhem, He is DYLAN BLACK!!!
The audience boos as Dylan raises his arm. Evan is still sitting on the top of the cage waiting for his turn.
Greg, The Assistant: And from the most beautiful city on this Godforsaken planet, Palm Springs, Califor-ni-ay, He weighs 229 pounds; He is the undisputed star of the Thursday Night Inferno intro open, Ask the woman sitting next you, he is the only F able guy on this roster, He’s the hood from the street that gets all the heat, MY GOD, JUST LOOK AT HIM!! He’s EVAN VALENTINE JR.!!!
Fans throw water bottles and trash at Evan Valentine Jr. perched on the top of the cage, but as most of their middle school gym teachers can tell you, they just don’t have the arm for that, son.
Wright: We wondered if these two would get along as the newest tag team in FIRESIDE, and by God, judging off the reaction of the fans, I think they’re going to get along just fine.
Park: Just fine doesn’t exactly prepare you for big matches like this, though!
Wright: Both men are former X-Crown champions, and Dylan is extreme as they come. A match like this isn’t totally outside of their wheelhouses, if anything they may thrie in the chaos of it.
Stanford: And their opponents… first, weighing a combined 460 pounds…
The lights dim down and the Tron shows "Top of the Class" in big gold letters with sparkles. It then cuts to images of Death Trap and Mistress Discipline working together in the 2020 rumble. "2285 Entr'acte" by Dream Theater plays over the speakers. Blue and Gold lights strobe the arena as the stage and ramp light up again and Death Trap and Mistress Discipline hit the stage. Mistress straightens her collar and begins marching to the ring. She gets ten steps away and looks back to see DT still doing his signature pose at the top of the stage.
Wright: Now here’s a team that doesn’t have that extreme edge, probably two of the best pure wrestlers in FIRESIDE today, but this type of match doesn’t play into any of their strengths.
Park: Oh contraire, Oliver. Did you not see Mistress mow down her competition with a sledgehammer? I believe she’s got an intense side inside of her ready to be unleashed. And Death Trap is no stranger to big moments, the former two-time X-Crown champ.
She marches back and grabs his arm and forcibly pulls him down the ramp to the ring as DT high fives fans with his free hand. Mistress steps through the cage door and rolls into the ring, stepping to the center while DT goes up the steps and looks out at the crowd as he steps through the ropes. He leaps to the closest corner and poses again as gold sparks shower from the ceiling. Discipline looks around quite unimpressed by all this hoopla, staring at her metallic surroundings. DT jumps down and the two begin to talk strategy as the lights return to normal.
Wright: What does this team have to do to prevail tonight?
Park: If they can choke their opposition out, that is probably their best bet. The longer the opposition lives and breathes, the more violent and extreme this match gets. If anything I’d expect them to try to keep a tight contain on the violence.
Stanford: …the team of Death Trap and Mistress Discipline, TOP OF THE CLAAAAAAAAAAAASSSSSSSSSSS!
The crowd cheers for the pair. Death Trap has his hands on Mistress’ shoulders, talking strategy as they await the arrival of the tag team champions. She nods in the affirmative and he releases his grasp, sliding his hat underneath the turnbuckles for safekeeping.
Wright: This is a big moment for this team, especially ahead of their XHF Tag Team championship match at the Rumble. Going into that match with both championships would be a huge uptick in their momentum.
Park: Easier said than done, though.
Stanford: And their opponents…
A DJ Marshmello crafted mash-up of The Game’s “One Blood” and Metallica's "Don't Tread on Me" plays over the PA as Curtis and El Combatiente emerge from the entryway wearing their Fireside tag team titles. Curtis also has an American flag he’s carrying down to the ring. El Combatiente's manager Javier follows shortly behind them. They look around soaking up their surroundings. Curtis hoists his flag into the air. El Combatiente breaks into a full sprint for the cage door and slides in once he’s arrived.
Wright: For 480 days, President Kanyon has ruled over the FIRESIDE Tag Team division, first with ‘Devilish’ Donny Deville, then with El Combatiente.
Park: It’s been a hell of a resume.
Wright: It includes wins over Jonnie Valentine, Vodka Fizz, the Time Jumpers, Masters of the Mat, Anthony Caffrey, MYOJIN, and more. This may be one of the greatest tag teams in the history of the XHF.
Curtis and Javier slowly walk to ringside and chat. El Combatiente stretches in the ring preparing for the match to begin as Curtis climbs a turnbuckle and points to the crowd with his hammer, then hoists it straight up into the air and yells "BANG!"
Stanford: …weighing a combined 489 pounds, the team of President Curtis Kanyon and El Combatiente, EL BANG HERMAAAAAAAAAANOSSSSSSSS!
Wright: There’s an electricity in the air here as these three teams are about to battle to conclude a beautiful night here in Spain. The door to the cage is locked, and we’re about to get under way!
Park: What do you think happens--
Wright: Look out!
Instead of handing their tag team championships off to the timekeeper, the FIRESIDE Tag Team champions start the match by running full speed at their opponents, swinging their championships at them! Mistress Discipline is cracked in the side of the head by El Combatiente’s championship while Dylan Black goes down as a result of President Kanyon’s assault! The bell rings!
Wright: Combatiente and Kanyon strike first with the tag team championships!
Park: It’s perfectly legal in a match like this, you’ve got to leave it to the champs to constantly be thinking of ways to get a leg up on their opponents!
Wright: This crowd is already loudly voicing their opinion!
The crowd continues to boo as Kanyon and El Combatiente work to grab Death Trap and restrain him. Evan Valentine Jr. wants no part in helping Death Trap, leaving the ring to look under the ring to go find a weapon or some other method of destruction. Kanyon whips Death Trap into the ropes and then ducks down for the highflyer to connect with a dropkick, knocking Trap down. Kanyon picks Death Trap back up and goes to whip him into the corner, but Trap manages to counter, but Kanyon just avoids being whipped into the corner full of barbed wire, only to come back and get dropped in an STO!
Death Trap goes to lock on a submission of some kind but El Combatiente is right on top of him, stopping him from getting going by dropping him to the mat with a DDT. The Californian is quickly surprised though by Mistress Discipline coming rushing in and clocking him with a running bicycle knee strike!
Wright: Final Bell from Mistress!
Park: A devastating knee strike like that could knock the champion out cold!
Mistress stands over her opponent for a second too long as the next thing the crowd hears is the sound of steel meeting flesh as Evan Valentine Jr. comes up from behind to smack her square between the shoulder blades with a steel chair! Mistress cringes in pain and goes down as Evan begins handing out chair shots like a mad man, one for Death Trap, one for El Combatiente, and another for Kanyon! He even almost strikes Dylan Black with how wildly he’s swinging the chair! Dylan stops him and communicates a plan to his partner, with both men grabbing Kanyon and rolling outside of the ring.
Wright: What do they have planned here?
Park: Whatever it is, it’s going to hurt!
Dylan Black grabs President Kanyon by a long strand of hair and pulls him closer to the cage, then presses his face against the structure! Evan Valentine Jr. gets a running start and leaves his feet, slamming Kanyon into the cage with a Picture Perfect Dropkick! The champ goes down and immediately begins to bleed as the crowd boos!
Wright: What a damn dropkick from the challengers!
Park: Payback for Jonnie all those months ago with a move like that!
The crowd boos even louder as Evan Valentine Jr. returns to his feet and immediately begins jawing at the lot of them. The two men exchange a highfive but are quickly taken out by a leaping El Combatiente crashing down onto both men with a senton from the top rope!
Wright: It’s a pile of bodies on the outside!
Park: Absolute carnage between the group here!
The pile of bodies leaves Top of the Class as the only team both standing and in the ring. Trap and Discipline communicate with each other for a few moments before both leaving the ring on opposite sides. The crowd cheers and chants for tables as Death Trap begins sliding them in like cards on a poker table, one after another, for a grand total of three tables. Discipline on the other hand is working by pulling out something much bigger. There’s a giant dark green canister that looks similar to a fire extinguisher, but judging by the pop from the crowd, they quickly realize that’s not what it is at all!
Wright: Wait a minute, what the hell--
Park: --holy shit, Chaos and the gang actually hooked her up with a flamethrower!
There is a devilish look in the otherwise subdued librarian’s eyes as she works to get the flamethrower set up, then does a tasteful test run, shooting some fire directly out in front of her! Luckily for the opposition, they are nowhere near the flames, but the metal on the cage where the fire was shot glows a different color for a few seconds!
Wright: She’s lost her damn mind!
Park: Bold of you to assume she had one in the first place!
Even Death Trap has a startled look as Discipline walks back up the steps with the flamethrower strapped to her back like it’s a backpack. He has set up one of the tables in the middle of the ring and the team prepares to ignite the wood before Death Trap is kneecapped from behind by Dylan Black and the Blacklight!
Wright: Blacklight! Dylan may have just evened his own odds!
Park: I’d be real damn careful about engaging Discipline when she’s armed with a damn flamethrower through!
Discipline goes to operate the flamethrower, but it unfortunately jams up just in time for Dylan Black to drop the bat and leap up onto her shoulders!
Wright: She’s not going to shoot that thing at herself, is she?
Park: She might, Oliver! She might!
Black punches down with his one good arm before falling backward, flipping Mistress Discipline and sending her crashing through the table with the Headstrong reverse hurricanrana! The crowd reacts strongly!
Wright: Discipline goes through the wood!
Park: She’s still in the match, but that had to hurt!
Discipline grabs her ribcage and yells out in pain as Dylan Black immediately works to remove the flamethrower from her and kick it to the outside of the ring. Evan Valentine Jr. spots it and seems to have some kind of idea, grabbing the dented device off the floor and beginning to look at how to operate the thing. Black barely manages to dodge a Blacklight shot from his former friend and associate El Combatiente!
Wright: The champ’s got his hands on the Blacklight!
Park: Talk about a rock and a hard place right now!
Evan: How the hell do I work this thing?
The two men have a look at each other, each man exchanging words. El Combatiente has taken an interest in the bat and gives it a few practice swings while Black seems to be speaking about doing things the respectful classy way. Javier on the other hand isn’t about to do an honorable thing, hopping up on the ring apron and immediately grabbing both referee Davenport and Black’s attention with his antics. Black’s eyes turn away for just a moment, but when they turn back, El is still there. In fact, he seems to have taken Dylan’s request literally, laying the bat at his feet. The crowd pops and cameras flash as these two are about to square off.
Wright: Two former friends about to settle it square in the middle of the ring!
Park: No weapons, no nothing but skills, wits, and talents! Here we go!
Combatiente wisely keeps the bat on the ground in front of him, which Dylan has been eyeing up as he looks to get his hands back on the weapon. The honorable wrestler is immediately disappointed as instead of locking up, Dylan dives for the Blacklight, trying to get his hand on it, but El Combatiente immediately stomps on his remaining hand! Black cringes in pain as El grabs him and looks to use the ropes for sliced bread, only for the champion to realize that there’s barbed wire right where he would put his feet for a launching pad! This realization is just enough time for Black to shove him with all of his weight straight into the barbed wire briar patch! Combatiente screams in pain!
Wright: You can’t be honorable with a guy like Dylan Black! Ohh, look at the blood as that wire opened him up!
Park: The cage is vicious, but the damned barbed wire will rip your flesh apart for breakfast!
As the champion drops to his knees, we see multiple parts of his body where the blood is now beginning to trickle out from open cuts. Dylan has only a tinge of regret on his face as he grabs the Blacklight, smiling as the crowd boos. He turns to look out at Evan, who has still been figuring out how the hell to get this damn flamethrower to work.
Evan: This thing should have instruct--
WHOP!
Another baseball bat makes contact with Evan’s side, almost immediately breaking a rib! Valentine crumbles down to the floor as Death Trap waves around his bat with a joyous look on his face.
Wright: Trap’s got a bat of his own!
Park: I’ve never seen Evan Valentine Jr. fall down harder! That looked painful!
Death Trap channels his inner Babe Ruth and points his bat at Black, who is ready for what this fight’s about to be. Trap quickly runs up the steps and back into the ring and the two men prepare to do battle, each armed with their own light-- excuse me, baseball bat.
Wright: Place your bets on what we’re about to see!
Park: I’ve got money on one guy getting smashed in the face with a baseball bat!
The duel looks something similar to a swordfight with both men disregarding usual MLB stances to swing their bats closer to clubs, each one trying to find an opening. Black starts with the advantage and manages to grace Death Trap’s leg, causing him to wince and take a step back, but when Black pursues Death Trap manages to counter by positioning his bat to block each of Dylan’s attacks and knock him off balance. As Dylan stumbles, Death Trap swings and catches him right on the collarbone, causing Black to drop the bat and drop to the mat instantly!
Wright: It was a brief war, but the older veteran gets the upper hand in the battle of the bats!
Park: It’s harder to swing effectively with one hand, but Death Trap at this rate is fresher and definitely ready to inflict more punishment!
Trap looks down at his opponent before spotting Dylan’s bat. He grabs it and smiles, suddenly armed with two bats. He waves the bats around before striking a pose for the crowd, forming a skull and crossbones with the bats forming the crossbones. They go bananas for it!
Wright: Two X-Crowns, two bats for Death Trap!
Park: It seems to be a lucky number for him!
Death Trap sets down the bats and grabs Dylan Black from behind, locking him into a dragon sleeper! He begins to choke out Black with all of the force he can muster!
Wright: Trap’s looking to put Black to sleep!
Park: That would make it much easier to put him through a flaming table! Dylan has to find a way out of this!
Things are immediately not looking good for Dylan as Trap has a look in his eyes as he keeps the submission applied. Davenport leans instinctively leads in to check on in Dylan, but with no submissions or knockouts in this match, the one-armed bandit is just going to be left to suffer. To his credit, Black fights back with his free hand, at first trying to fire a shot into Trap’s stomach but then insisting on reaching out to grab the ropes. Unfortunately with the match not having rope breaks, it makes no difference to DT that Dylan has actually grabbed them, as he instead pulls Dylan right back away from the ropes. Dylan begins to fade, dropping from a position supported by the weight of both feet to the weight of only one. He looks to be in danger of passing out!
Wright: You can trap a veteran like this in a cage, but all it’ll do is make them more resourceful!
Park: I think he’s about to take Black out of this match! Someone get a table prepared!
As Black drops to a laying position, Death Trap looks over his shoulder, checking for other competitors but also eyeing up the barbed wire turnbuckles. He hoists Dylan back up and begins walking back the dragon sleeper, and it looks like he’s preparing to throw Black through into the corner!
Wright: Black’s not moving! Trap’s got him dead to rights!
Park: The shock of getting pierced by the wire might be enough to return him back to consciousness!
Death Trap goes to wind Black back, but Black has a bit of fight left in him, throwing another elbow! He may be about to get out of this, right before Kanyon slides into the ring and charges, BANGING both men into the barbed wire corner!
Wright: Oh my God!
Park: Ow! Ow! All three men just went into the barbed wire! Jesus!
A cacophony of screams pierce the Spanish arena followed by cheers and booing as Kanyon, Black, and Trap all caught various tangles of barbed wire and have begun to bleed in the corner. Death Trap did not have a fun time, having been driven back into the barbs by the weight of both of his competitors. Black has instinctively rolled out under the ropes and immediately collapsed on the floor outside of the ring, grabbing his midsection while his back and shoulder begin to color the ground. Medical staff quickly emerge from the back, realizing they should have started the match out here in the first place, but also to check on him.
Wright: Dylan looks like he absolutely caught the worst of that!
Park: With how he’s bleeding, I would assume his cuts are much more than skin deep!
To his insane credit, Kanyon is instead using the ropes, grabbing them to pull himself back up. He brushes off the cut above his left eye, wincing as he tries to clear the blood from his vision. He rolls outside of the ring and looks for something underneath the ropes, before sliding another table and a gas canister into the ring!
Wright: Who got this man a gas canister?
Park: With the price of gas these days, that must have been expensive!
Wright: The man’s a psychopath, UnJoo, plain and simple!
The last thing Kanyon grabs from underneath the ring is his trusty hammer, Mjölnir. The crowd boos as Kanyon gives the head a little kiss before sliding back into the ring with it, eyeing up Death Trap. He drags Trap back into the center of the ring, sets him up into a kneeling position… and begins singing?
Kanyon: Geeeeeee Offiicer Krupke, we’re down our knees--
Kanyon forcibly swings the hammer, striking Trap right in the collarbone! Death Trap screams out in bloody pain as he goes down!
Kanyon: --’cuz no one wants a fella with a social disease!
Kanyon swings Mjölnir again, this time striking his leg! At this point, Kanyon might be… dancing as he walks into the corner, grabbing something.
Wright: Why the hell is he singing? This man is insane!
Park: I believe that’s West Side Story, they were singing in it in the lead-up too!
Kanyon: Gee Officer Krupke, what are we to do?
Kanyon picks Trap’s hat out of the corner and smashes it with the hammer, laughing in joy!
Wright: He’s sick! He’s sociologically sick! Not even the hat is safe!
Park: Who’s gonna stop him though?
Kanyon: Gee Officer Krupke, KRUP YOU!
Kanyon winds up for an overhead shot, only for his grip to be interrupted by Mistress Discipline reaching out and grabbing the hammer with both hands! The two tussle over the hammer with Kanyon getting the edge!
Wright: Watch out Discipline!
Park: This might be about to get a whole lot less pretty!
Kanyon swings the hammer at Discipline, but she ducks underneath and slides under his legs, before popping back up and locking him into a choke from behind, the Dunce Cap!
Wright: Discipline’s got her own choke on Kanyon!
Park: This is her vengeance! Get him, Mistress!
Discipline keeps the grip fully applied as Kanyon begins wildly flailing around, trying to get the hammer in the right position to strike Mistress and free himself. He swings at her legs and feet, but each time he swings he exerts more energy and just misses striking! Kanyon begins to fade as the crowd cheers!
Wright: She’s choking him out! It’s working!
Park: Discipline has this crowd on their feet!
Mistress Discipline keeps the hold applied like her life depends on it as Kanyon’s face begins to turn bright beet red. The air is coming out of him like an untied balloon as he drops the hammer before dropping to his knees! The crowd begins making noise and pointing rapidly at Discipline, as behind her El Combatiente has armed himself with a chair, but it’s too late as he strikes her and free his partner! She drops to the mat clutching her head after the brutal shot!
Wright: What a shot from that chair!
Park: That’s teamwork for you! The champ saves his partner!
El Combatiente wastes no time in grabbing Mistress and turning her around before lifting her up onto his back, and then dropping her onto the chair with his version of the vertibreaker!
Wright: Street Justice right onto that chair!
Park: That’s a move that has ended the night of so many tag team competitors of El Bang Hermanos, raised up to 11 by dropping her like that!
Wright: Now he’s just got to light up one of the tables!
El Combatiente makes it back to his feet as the crowd is booing wildly. He ignores the crowd before setting up one of the remaining tables and grabbing the gasoline canister, pouring some of it on the surface before reaching into his boots and pulling out a box full of matches. The crowd goes wild as he strikes the match and drops it, nearly instantly lighting the table on fire!
Wright: This match is about to get all kinds of fired up!
Park: Don’t let Caffrey hear you saying that!
The cameras capture the flaming table as El Combatiente looks at his handiwork and prepares to put Discipline through the device, when we hear the sounds of the flamethrower being operational again!
Wright: What--
Park: Evan Valentine Jr. has gotten the flamethrower working again! Run for your lives!
Wright: I don’t think he’s using it on anyone or anything -- he’s pointing it at the door!
A closer examination reveals that Evan Valentine Jr. isn’t necessarily pointing the flamethrower at the door, he’s pointing it at the padlock keeping the door closed! The top part of the lock doesn’t melt or budge, but the bottom part of the padlock begins to melt away under the direct heat!
Wright: He’s melting the lock! That lock is going to be down to nothing in a few seconds!
Park: I don’t think that’s quite how it works, but it’s working!
Valentine has a grin on his face a mile wide as he’s both shooting a flamethrower and has managed to successfully melt the bottom of the padlock! The top metal part stays mostly intact but the locking mechanism falls away. He boots the door, sending it swinging open, then yells at the entrance ramp until both Brian and Lance Valentine come running down the ramp to join him!
Wright: This is Rage in a Cage! That cage is supposed to stay locked!
Park: When would Valentine ever follow the rules?
The Valentine clan has infiltrated the cage, much to the displeasure of the crowd, and much to El Combatiente who finds himself in front of a flaming table and surrounded by a pack of Valentines now standing on the apron on each side. He grabs the hammer and arms himself, ready to inflict punishment on the first Valentine that moves. The staredown is intense but Evan calls in the dogs to sick him, only for it to immediately backfire as El Combatiente strikes Brian with the hammer, then Lance, both right in the skull!
Wright: If the champ’s going to go down, he’s going down swinging!
Park: He’s got both of the-- oh no!
Evan Valentine Jr. charges, leaving his feet to hit another Picture Perfect dropkick, sending El Combatiente straight through the flaming table!
Wright: One half
Park: He’s got both of the-- oh no!
Combatiente’s legs flail wildly as the champion spends another few moments on fire before managing to roll the fire out! A technician at ringside quickly sprays down the champ and the still-burning table with a fire extinguisher!
Wright: The price the Valentine family just paid was worth its weight in gold as Combatiente goes through the table!
Park: Look at his flesh! Oh my God! I can smell it!
Wright: Rage in a Cage can take years off your career, and that’s exactly why! What a brutal moment!
Park: And now if Kanyon also goes through a table, we’ll have guaranteed new tag team champions!
The FIRESIDE Tag Team championships look to be in danger as both champions are still down, with one half having already been sent through a flaming table. Evan Valentine Jr. sets up another table, not even bothering to check in on his cousins as he goes to grab one of the tables laying around, beginning to set it up to put someone else through. He spots the gas can, but he then spots the flamethrower, and in an act of youth, grabs the flamethrower again, igniting another table! The crowd reacts to the fire once again!
Wright: Five people are going to go through flaming tables tonight UnJoo!
Park: It’s the sacrifices they’ll all make on the way to become or retain the FIRESIDE tag team championships!
Valentine goes to position a table in the corner as well, leaning it against the barbed wire. Technicians at ringside yell at him to do literally anything other than ignite the table and the barbed wire in the corner for fear of the ring ropes also catching ablaze, but if you give a mouse a cookie, he’ll ask for a glass of milk, and if you give a Valentine a flamethrower, he absolutely is going to goddamn use it.
Wright: He can’t light up that table in the corner there! It might spread!
Park: I think he can’t hear us!
The woman who brought the flamethrower to the party in the first place has risen back to her feet, grabbing the back of her bloody head and holding her neck as she grabs the Blacklight off the ground, swinging not for Valentine himself, but the flamethrower strapped to his back! The sudden jolt of it being hit sends Valentine jumping forward, almost sending himself into the flame!
Wright: Discipline just hit the flamethrower instead of the pack! Park: Look at that huge dent! If she hits it again, it’ll open!
Both commentators realize at the same time that’s exactly what she wants to do. Valentine isn’t as quick to realize it as he turns back to face Discipline, who strikes him in the gut with the bat! He drops to his knees, but instead of Discipline striking him again, she strikes the flamethrower, opening the dent wider, leading to fuel beginning to pour out!
Wright: Oh hell no! Hell no! I don’t like Valentine but not like this!
Park: This whole goddamn ring is gonna burn at this rate!
Fuel begins to rapidly spill out from the pressurized flamethrower being punctured, but that’s not so much the immediate problem for Valentine instead as he finds himself hoisted up onto Discipline’s shoulders, then powerbombed through the table!
Wright: EXPULSION THROUGH THE FLAMING TABLE!
Park: Evan’s on fire! Put him out, put him out!
Valentine screams in pain as more of his body is engulfed due to the fuel from the flamethrower having spilled on his body. The ringside technicians quickly work to extinguish the fire and then some, emptying an entire extinguisher to prevent an explosion, but the damage has certainly been done and the crowd’s bloodlust has been temporarily satiated. Discipline realizes she has some of the fuel on her leg as well and looks down to try to wipe some off---
--only to be immediately caught with Mjölnir to the side of the head! She goes down in a bloody heap!
Wright: What a SHOT from Mjölnir!
Park: These people are clearly trying to murder one another! Good God!
Wright: It’s about to get worse!
Kanyon grabs a rapidly bleeding Discipline and looks over at the table in the corner that has been burning this whole time, setting her up on his shoulders and running and depositing her through the flaming table in the corner, right into the barbed wire briarpatch on the other side!
Wright: OH GOD! DISCIPLINE GETS EXPELLED!
Park: Her leg! Someone put out her leg!
Wright: This is chaos! This is madness!
Park: I know what human flesh smells like burnt, and it’s not a pleasant smell folks!
Technicians work to extinguish Discipline as she yells out in pain and suffering, wildly flailing about as she manages to get her leg to stop being on fire, but also has to deal with having multiple barbs stuck in her! She manages to peel out of the corner and drops down to the floor right in front of a shocked and dismayed Death Trap!
Wright: His poor girlfriend, one of the best FIRESIDERS to ever do it, brutally set on fire like that!
Park: Someone’s gotta end this! Oh my God!
Wright: Every team has had a member of their group go through a flaming table, two more wrestlers are left!
An angered Death Trap does his best to comfort Discipline, but she gives him a message through the pain to go win the match. He grabs his baseball bat and slides into the ring, eyeing up Kanyon for payback.
Wright: Here we go, bat vs. hammer!
Park: Wait a second!
They are then joined in the ring by Dylan Black, who isn’t wielding a Blacklight, but instead has gotten his hands on a ladder.
Wright: Black’s okay to go after that brutal BANG earlier, and now it’s bat vs. hammer vs. ladder!
Park: One is clearly not like the others!
The one-armed Dylan Black has to do his best to manage, but manages to immediately take out both of his competitors by running full speed into them with the ladder in front of him! Kanyon and Trap both go down as Black hands out ladder shots like he’s Oprah giving out cars before setting up the ladder near one of the corners. He grabs a remaining table and sets it up, igniting it with the gas and matches combination for lighting up a second table as well! He grabs Kanyon and drags him towards the ladder, before also grabbing Death Trap and doing the same! Then, he exits the ring to the apron, where he climbs up on the ropes, then uses the ropes to climb up to the top rung of the ladder, looking down on both men!
Wright: Dylan’s going to fly here!
Park: The FIRESIDE Tag Team championships may only be a leap away here!
Wright: This could be it!
Dylan looks to throw it all away to win the titles as Kanyon and Death Trap make it back to their feet, right up until the moment that Javier throws a chair straight into his face!
Wright: Javier makes his salary worth it to El Bang Hermanos, striking down Dylan Black!
Park: He’s still up there leaning on the ladder now!
The crowd boos loudly as referee Melanie Davenport scolds Javier, who pleads the fakest fifth in the world. One wrestler not willing to accept the plea is Death Trap, who grabs him and looks at the flaming table, before having second thoughts and planting him with a cradle DDT instead!
Wright: Main Attraction!
Park: For a split second there I really thought Death Trap was about to send Javier through one of these damn tables!
Death Trap looks up at what seems to be a barely-conscious Dylan Black and a struggling President Kanyon, realizing this is his moment. It is going to be a struggle with all 270 pounds of Kanyon, but the former X-Crown champion lifts the other champion slowly up onto his shoulders, struggling under the weight but keeping his composure as he gets him in the right position!
Wright: We haven’t seen this in forever -- Death Trap’s got him up, with herculean strength, into position for the One of a Kind!
Park: If he hits this, we’re guaranteed new champs!
Kanyon realizes his 480-day reign is in danger, fighting as hard as he can to elbow his way out with every ounce of his being, struggling desperately to free himself, but Trap has remembered the words of Discipline telling him to win and hangs on, ready to swing him around for the F5!
Wright: Do it Trap, do it!
Park: This move could be about to change history!
Right as Death Trap is about to release for the One of a Kind, Dylan Black leaps off the ladder and comes crashing down with a Picture Perfect Dropkick, sending the collective through the table!
Wright: HOLY SHIT-- SHADES OF EVAN WITH THE PICTURE PERFECT DROPKICK!
Park: THAT’S IT! THAT’S IT! THE BELL JUST RUNG! DING DONG, THE WITCH IS DEAD!
The group screams in pain as every man has caught some of the flames as the bell rings!
Stanford: Here are your winners, and the NEEEEEEEEEWWWWWW FIRESIDE TAG TEAM CHAMPIONS, NEW APPENDAAAAAAGESSSSSS!
Wright: IT’S OVER! IT’S OVER! THANK GOD! GOD, AS LONG AS I LIVE, I NEVER WANNA SEE A MATCH LIKE THAT!
Park: PUT ‘EM OUT! SOME OF THEM ARE STILL ON FIRE!
The celebrations, cheering, and booing will have to wait at least a moment as Dylan Black, Death Trap and President Kanyon are all extinguished by the ringside technicians. Once all the fire is out, confetti begins to rain down throughout the Spanish arena, though dear God, it’ll be hard to celebrate any time soon with the state of every wrestler in the match. Even Valentine is barely able to crawl over to his partner, one half of the new tag team champions.
Wright: I cannot believe what I just saw. What a match, what a battle, what a war, I had no idea this was going to get this violent.
Park: Everyone has gone through flaming tables, years of life have been taken from these competitors, all in search of the glory of the ultimate prize in tag team wrestling: the FIRESIDE Tag Team Championships.
Valentine tries to wake up Black to celebrate, but Black is out cold from from his head bouncing off the mat as he landed the dropkick. The pair are handed the titles and bombarded by the somehow-conscious Valentine cousins as the crowd begins to boo loudly.
Wright: The greatest tag team champions of our generation fall tonight at the hands of New Appendages!
Park: Don’t forget Top of the Class! Death Trap rose to his usual level of greatness, and if you didn’t know Discipline could hang with these five tonight, you damn well sure know now!
Wright: I’m exhausted. Ladies and gentlemen, that’s it for us here in Spain, my name is Oliver Wright, that’s UnJoo Park.
Park: Goodnight!
The show ends with a final shot of the Valentines and Black, laying in the ring with their new tag team championships.